 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circVAPA | |||
| Gene | Organism | Human | |
| Genome Locus | Build | hg19 | |
| Disease | Colorectal Cancer | ICD-10 | #N/A (C19) |
| DBLink | Link to database | PMID | 31368365 |
| Experimental Method | |||
| Sample Type | Tissue and cell lines | Comparison | A total of 60 matched pairs of CRC and adjacent normal mucosatissues were collected along with peripheral blood samples |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward TGGATTCCAAATTGAGATGCGTATT ReverseCACTTTTCTATCCGATGGATTTCGC | Statistics | Fold Change : Upregulated pvalue : <0.05 |
| Citation | |||
| Liu, C, Zhong, X, Li, J, Xu, F (2019). Circular RNA circVAPA Promotes Cell Proliferation in Hepatocellular Carcinoma. Hum Gene Ther Clin Dev, 30, 4:152-159. | |||